User:Quolla6/Temporary

Watchers

This is a temporary page to hold information for a short term discussion. It will be deleted in a few days Q 16:41, 1 May 2012 (EDT)

Note

Based on data provided by Anatole Klyosov"

If you take, say, SNPV21, and find the respective 100 bp of human Y chromosome in which this SNP is "built in", you get:
gaacagccacctccaagccaaggagacagaactgattctccctcaccacc t ttagaaggaactaaccctaccagtgcgttgatctctgaattctgtattc

Then you take the respective 100 bp in chimpanzee Y chromosome, and what you will see?

gaacagccacctccaagccaaggagacagaactgattctccctcaccacc с ttagaaggaactaaccctaccagtgcgttgatctctgaattctgtattc
Can you see the difference? Yes, exactly, only that C-->T mutation. One base per these hundred ones.

 

Comparison

HumanChimpanzee
g g
a a
a a
c c
a a
g g
c c
c c
a a
c c
c c
t t
c c
c c
a a
a a
g g
c c
c c
a a
a a
g g
g g
a a
g g
a a
c c
a a
g g
a a
a a
c c
t t
g g
a a
t t
t t
c c
t t
c c
c c
c c
t t
c c
a a
c c
c c
a a
c c
c c
t
t t
t t
a a
g g
a a
a a
g g
g g
a a
a a
c c
t t
a a
a a
c c
c c
c c
t t
a a
c c
c c
a a
g g
t t
g g
c c
g g
t t
t t
g g
a a
t t
c c
t t
c c
t t
g g
a a
a a
t t
t t
c c
t t
g g
t t
a a
t t
t t
c c
Fundraiser
Help fund new features!